What role do periodontal pathogens play in osteoarthritis and periprosthetic joint infections of the knee?

Ehrlich, Garth D.; Hu, Fen Z.; Sotereanos, Nicholas; Sewicke, Jeffrey; Parvizi, Javad; Nara, Peter L.; Arciola, Carla Renata

doi:10.5301/jabfm.5000203

What role do periodontal pathogens play in osteoarthritis and periprosthetic joint infections of the knee?

Abstract

Through the use of polymerase chain reaction (PCR)-electron spray ionization (ESI)-time of flight (TOF)-mass spectrometry (MS), we identified multiple periodontal pathogens within joint tissues of individuals undergoing replacement arthroplasties of the knee. The most prevalent of the periodontal pathogens were Treponema denticola and Enterococcus faecalis, the latter of which is commonly associated with apical periodontitis. These findings were unique to periprosthetic joint infections (PJI) of the knee and were never observed for PJIs of other lower extremity joints (hip and ankle) or upper extremity joints (shoulder and elbow). These data were confirmed by multiple independent methodologies including fluorescent in situ hybridization (FISH) which showed the bacteria deeply penetrated inside the diseased tissues, and 454-based deep 16S rDNA sequencing. The site-specificity, the tissue investment, and the identical findings by multiple nucleic-acid-based techniques strongly suggests the presence of infecting bacteria within these diseased anatomic sites. Subsequently, as part of a control program using PCR-ESI-TOF-MS, we again detected these same periodontal pathogens in aspirates from patients with osteoarthritis who were undergoing primary arthroplasty of the knee and thus who had no history of orthopedic implants. This latter finding raises the question of whether hematogenic spread of periodontal pathogens to the knee play a primary or secondary- exacerbatory role in osteoarthritis.

J Appl Biomater Funct Mater 2014; 12(1): 13 - 20

Article Type: ORIGINAL RESEARCH ARTICLE

DOI:10.5301/jabfm.5000203

Authors

Garth D. Ehrlich, Fen Z. Hu, Nicholas Sotereanos, Jeffrey Sewicke, Javad Parvizi, Peter L. Nara, Carla Renata Arciola

Article History

• Accepted on 09/11/2013
• Available online on 02/06/2014
• Published online on 12/06/2014

Disclosures

Financial support: This work was funded in part by Allegheny General Hospital’s Department of Orthopedic Surgery, the Allegheny Singer Research Institute, and grants from the Pittsburgh Foundation (GDE), and Abbott Molecular (FZH). Contribution from the “5 per mille” grant for Health Research to the Rizzoli Orthopaedic Institute is also acknowledged.

Conflict of interest: FZH received grant support for this study from Abbott Molecular; GDE serves as a consultant to Abbott Molecular.

This article is available as full text PDF.

Download any of the following attachments:

INTRODUCTION

Bacterial biofilms are frequently formed in biological systems and are characterized by bacteria adopting a multicellular lifestyle (1-2-3). In the case of pathogens, the development of the biofilm state is related to their intrinsically high resistances to both the host’s immune defenses and standard antimicrobial treatments. These factors together with powerful adherence mechanisms provide for the extraordinary abilities of bacterial biofilms to persist within the host leading to chronic, often incurable conditions (4-5-6-7-8-9-10-11-12-13-14). Thus, bacterial biofilms are the prototypical population-level virulence factor (15), as they manifest only when bacteria adopt a multicellular life style. This includes promoting other population-based virulence behaviors such as horizontal gene transfer (8, 16-17-18) and quorum sensing capabilities (19-20-21). Like many virulence factors, these mechanisms evolved in response to the internecine battles between bacteria (22). Implantable medical devices are at a high risk of becoming encrusted with bacterial (and fungal) biofilms (3, 23-24-25). Due to the ineffectiveness of traditional, culture-based, microbial detection strategies and antimicrobial strategies for the control of biofilms, respectively, great effort is being expended to identify biofilm-specific targets for both diagnostics (26, 27) and interventions (28-29-30-31-32-33).

We and others have previously documented periprosthetic joint infections (PJIs) of the ankle, knee, hip, elbow and shoulder in culture-negative cases (11, 34-35-36-37-38-39-40) and in cases of hip fracture associated with osteoporosis (41). Some of these PJIs are associated with known medically-important pathogens such as Staphylococcus aureus (11, 35, 36), whereas others are caused by previously unknown and/or rare pathogens such as Bacillus cereus (37). Current treatment options for PJIs are largely limited to expensive, time consuming, painful excision of the infected prosthesis, followed by the placement of antibiotic-laden spacers and subsequent revision arthroplasty after sterilization of the site (42). The mechanisms of biofilm resistance to antibiotics are starting to be decoded, with the realization that metabolic quiescence induced by oxygen limitation (43) and the stringent response are necessary for survival following antibiotic treatment (44). Based on these findings, some generalized methods of treatment for biofilms are now emerging with the realization that metabolic stimulation can render formerly quiescent biofilms at least partially sensitive to treatment (45). However, perhaps the best hope lies with the future development of intelligent implants (4, 6, 23, 46) that can both sense and treat nascent infections prior to the establishment of a mature biofilm, since the removal of a mature biofilm is very difficult due to the enormous heterogeneity of the component cell populations (4, 6, 8).

One of the biggest challenges in the treatment of biofilm infections is their accurate diagnosis. Biofilm bacteria are intrinsically difficult to culture, and prior treatment with antibiotics greatly exacerbates this problem (47).Thus, other methods must be developed and employed for their clinical detection. Until recently, however, DNA-based molecular diagnostic (MDx) methods also suffered from many limitations, most importantly from a lack of breadth (48, 49). This manifested as a high positive predictive value for the test organism, but a very low negative predictive value overall, as infectious disease physicians and clinical microbiologists essentially had to guess what species to test for; and if they guessed wrong there was no test that provided adequate coverage. The Ibis technology revolutionized MDx and essentially did away with the need for culturing (50-51-52-53). This technology combined the exquisite sensitivity of PCR-based methods with unheard-of breadth of coverage. This was accomplished by uniting multiple technical advances with powerful diagnostic algorithms capable of accessing immense databases (50, 53). In practice, the Ibis technology utilizes multiple PCR primers to a battery of highly conserved (pan-domain) sequences, as well as employing primers specific to various mid-level taxa. Each primer comes with its own internal standard that serves as a test for amplification and also for quantifying the number of genome equivalents of any identified target sequence. This makes it possible to determine the relative levels of different species in a polymicrobial infection. After amplification (and a desalting step) the amplimers are ionized via electrospray ionization (ESI) which serves to gently denature the two strands such that each intact strand enters the TOF and is weighed. The ESI is critical in this regard as it does not produce fragmentation as MALDI would, thus the exact amplimer weight is determined twice – once for each strand, with each strand serving as a control for the other. The MW of each strand is then used to determine the exact base composition of the amplimer, i.e., how many As, Gs, Cs, and Ts there are using a deconvolution algorithm. This works similarly to weighing a pocket full of change and from the weight deciphering how many each quarters, dime, nickels, and pennies there are. Once the base composition is determined, it is compared against a massive database which holds the DNA sequence data for each species. Through an iterative process of examining the base compositions of multiple amplimers, a species-level diagnosis is achievable in essentially all cases.

In the incumbent study, we evaluated both PJIs and native knees undergoing primary arthroplasty for osteoarthritis for the presence of periodontal and apical periodontal pathogens using the Ibis technology and compared these results with deep 16S sequence analysis and/or 16S FISH.

METHODS AND MATERIALS

DNA extraction and Ibis T5000 eubacterial domain assay

In summary, total DNA was extracted from aspirates and tissue samples, and the bacterial DNAs were amplified by polymerase chain reaction (PCR) (49) using the 16 primer pair BAC system developed by Ibis (50). The individual amplicons were then “weighed” using the Ibis T5000 electrospray ionization (ESI) time-of-flight (TOF) mass spectrometer (MS). The species identities of the amplicons were then revealed using a database containing base composition data on virtually all bacterial species sequenced to date.

For the tissue and membrane samples, 1 mm³ of tissue or membrane was placed into a sterile microcentrifuge tube containing 270 μL of ATL Lysis buffer (Qiagen, Germantown, MD, USA; cat# 19076) and 30 μL proteinase K (Qiagen; cat# 19131). For aspirate samples 1 ml of aspirate (in RNA later) was centrifuged at 10000 rpm x 3 min, then 900 μL of supernatant was removed. ATL lysis buffer and proteinase K were then added as above. Samples were incubated at 56°C until lysis of the material was noted by visual inspection (typically ~12 h). One hundred microliters of a mixture containing 50 μL each of 0.1 mm and 0.7 mm Zirconia beads (Biospec, Bartlesville, OK, USA; cat# 11079101z, 11079107zx, respectively) were added to the samples which were then homogenized for 10 min at 25 Hz using a Qiagen Tissuelyser. Nucleic acid from the lysed sample was then extracted using the Qiagen DNeasy Tissue kit (Qiagen; cat# 69506). Ten microliters of each sample was loaded per well onto the BAC detection PCR plate (Abbott Molecular, Carlsbad, CA, USA; cat# PN 05N13-01). The BAC detection plate is a 96-well plate containing 16 primer pairs per assay that survey all bacterial organisms by using omnipresent loci (e.g., 16S rDNA sequences), phylum/class/order specific loci, while some are targeted to specific pathogens of interest (e.g., the Staphylococcus-specific tufB gene). The system also detects the presence of several key antibiotic resistance markers: van A and van B (vancomycin resistance) in Enterococcus species, KPC (carbapenem resistance) in Gram-negative bacteria, and mec A (methicillin resistance) in Staphylococcus species. An internal calibrant of synthetic nucleic acid template is also included in each assay, controlling for false negatives (e.g., from PCR inhibitors) and enabling a semi-quantitative analysis of the amount of template DNA present. PCR amplification was carried out as in (53). The PCR products were then desalted in a 96-well plate format and sequentially electrosprayed into a TOF mass spectrometer. The spectral signals were processed to determine the masses of each of the PCR products present with sufficient accuracy that the base composition of each amplicon could be unambiguously deduced. Using combined base compositions from multiple PCRs, the identities of the pathogens and a semi-quantitative determination of their relative concentrations in the starting samples were established by using a proprietary algorithm to interface with the Ibis database of known organisms.

Fluorescence in situ hybridization

Fluorescence in situ hybridization (FISH) analysis of selected samples was carried out as previously described (54). Briefly, specimens were fixed in 4% para-formaldehyde, then washed three times with PBS, and stored at -80° C in 1 : 1 ethanol/PBS until processed. The bacterial cells were permeablilized, and hybridized with FISH probes, by methods described under supplementary methods in Nistico et al (55). The FISH-stained tissue was then mounted and imaged using confocal laser scanning microscopy. Probes used to perform FISH on any given sample were selected based on the Ibis or culture results, and corresponded to either species-specific, genus-specific, or “universal” eubacterial probes.

Deep 16 S rDNA sequencing

Samples from patients in this series were analyzed by the creation of 16S clone libraries in cases in which there was sufficient material to provide bacterial DNA for this process. These clone libraries were then analyzed using the GS titanium system developed by 454 Life Sciences (Branford, CT, USA), and bacteria were identified at the species or (more commonly) at the genus level. We designed 114 different Multiplex Identifier (MID) tagged 16S PCR primers. The primers were generated by combining the 454 sequencing primer keys, an exclusive 10-base MID adaptor, and a 16S rRNA targeted sequence. DNAs from 113 different orthopedic samples and one negative control were used as PCR templates. PCR were performed in 50 µL reactions containing 1× High Fidelity PCR Buffer, 2.0 mM MgCl₂ solution, 0.8 mM dNTP Mix, 1 U Platinum Taq High-Fidelity (Invitrogen, Carlsbad, CA, USA), 0.4 µM each primer (Integrated DNA Technologies, Coralville, IA, USA) and 5 µL of DNA extract. Cycling was performed with an initial denaturation step at 94°C for 2 min followed by 30 cycles of 94°C for 30 seconds, 55°C for 30 s and 72°C for 60 s, followed by a final extension of 7 min at 72°C. Five microliters of the PCR products were visualized on 1% agarose gels. Positive PCR products were purified using the Agencourt AMPure XP system (Beckman Coulter, Brea, CA, USA) and quantified using Quanti-iT PicoGreen dsDNA Assay Kit (Invitrogen). All primers that produced 16S PCR fragments were diluted to equimolar concentrations (48 pg/µl). PCR products were then pooled into two groups of samples to create two amplicon libraries. GS Titanium SV emPCR (Lib-A) and GS Titanium sequencing (454 Life Sciences) were then performed on the amplicon libraries according to the manufacturer’s guidelines. Following conclusion of the sequencing run, reads from the 454 16S sequencing run were separated by MID (sample), and the MIDs were stripped from the reads. Each sample’s reads were then analyzed using the RDP classifier online tool (http://rdp.cme.msu.edu/classifier/classifier.jsp).

RESULTS

Patient population, specimen types, and testing modalities

A series of 40 revision arthroplasties of the knee (n=25), hip (n=14), and ankle (n=1) were evaluated by microbial culture and molecular diagnostics (MDx) for the presence of microbial infection, regardless of the clinical indication for surgery. Thus, the patient population included both individuals with clinical signs and/or symptoms of infection, as well as subjects suspected of having sterile loosening in the absence of infection. Specimen types included pre-surgical aspirates, and tissue and pseudomembrane (biofilm) collected during the surgical arthroplasty excision process. Patients were considered culture-positive even if only a single culture (often out of five or more) supported growth of a pathogen. All specimens were also evaluated using the Ibis T-5000 BAC assay which is an MDx based on PCR-ESI-TOF-MS that provides eubacterial pan-domain detection, speciation, and quantification of both single agents and polymicrobial infections. In addition, the BAC assay provides coverage for Candida and produces a molecular antibiogram based on the amplification and detection of known antibiotic resistance genes. Any bacterial species detected by either culture or Ibis from all specimens were then evaluated using 16S FISH visualized by confocal laser scanning microscope (CLSM) as a confirmatory assay. DNAs from a majority of the specimens were also used to prepare 16S amplicon libraries for deep sequencing using the Roche-454 Lifesciences pyrosequencing technology. In a few cases there was insufficient specimen or inadequate amplification to permit deep sequencing.

Ibis BAC assay results vs. microbial culture

Periodontal pathogens were detected by the Ibis BAC assay in 12/25 (48%) of knees, in 0/13 hips and 0/1 ankles. The difference between knees and hips was highly statistically significant using a Chi-square analysis (p=0.0032; 95% CI=1.96). Microbial culture did not detect periodontal pathogens in any of these specimens. This joint specificity to the knee was striking, and supported the veracity of these results, arguing against some external source of contamination. Moreover, in the majority of these cases the periodontal pathogens were found in multiple specimen types. In total, 32/63 (52%) of all Ibis tests from all subjects having at least one specimen positive for a given periodontal pathogen were periodontal pathogen-positive for that species. Treponema denticola was the most frequently detected periodontal pathogen being identified in 11 patients (15 total detections), followed by Enterococcus faecalis with findings in eight patients (13 total detections), and Brevundimonas diminuta being found in two patients (4 total detections). We also frequently detected other oral bacteria, primarily streptococcal species, including S. gordonii, S. mitis, and S. intermedius in this specimen set. Interestingly, the vast majority of cases in which periodontal pathogens were identified in the absence of fulminant species such as Staphylococcus aureus or Staphylococcus epidermidis had been clinically typed as aseptic loosening by the attending surgeons, suggesting that these bacteria do not produce the typical signs and symptoms of acute infection.

Results of confirmatory and validating tests

To confirm the detection of the periodontal pathogens identified by Ibis, but not by culture, 16S FISH analyses were performed on tissue/pseudomembrane specimens using probes specific to the species (or genera) identified by the primary detection modalities (Tab. I). In all cases, one or more of the Ibis-identified periodontal pathogens was detected by species-specific FISH as being invested within the tissue (Figs. 1-2-3). In some cases both T. denticola and E. faecalis were identified via FISH in the same specimen; B. diminuta was FISH-positive in the single specimen analyzed. Deep 16S pyrosequencing was used as an independent method to validate the Ibis results since, like the Ibis, it is an agnostic test with respect to species and should detect any species present. T. denticola or an untypeable spirochaetales (due to inadequate sequence) was identified in six cases, an Entercoccaceae was identified in two cases, and B. diminuta was detected by 16S in both Ibis-positive cases, and in an additional case that was Ibis-negative for this pathogen. Overall, the results of the deep 16S sequencing were incomplete, with many of the specimens not yielding adequate 16S libraries for sequencing, hence in more than half of the cases we had essentially no 16S deep sequence data, however for those cases where we obtained a reasonable number of reads the correlation between the Ibis results and the pyrosequencing were very good.

Fig. 1 -

Detection of Treponena denticola from a periprosthetic infection of the knee. The presence of T. denticola detected by the Ibis BAC assay was confirmed via 16S FISH performed on tissue removed during excisional surgery for this primary arthroplasty. The bacteria appear as redish pink, the blue is reflected light.

Fig. 2 -

Detection of Enterococcus faecalis from a periprosthetic infection of the knee. The presence of E. faecalis, originally detected by the Ibis BAC assay, was confirmed via 16S FISH specific for E. faecalis which was performed on tissue removed during excisional surgery for this primary arthroplasty. The bacteria appear as redish pink, the blue is reflected light.

Fig. 3 -

Detection of Brevundimonas diminuta from a periprosthetic infection of the knee. The presence of Brevundimonas diminuta, originally detected by the Ibis BAC assay, was confirmed via 16S FISH generic for Brevundimonas sp. which was performed on tissue removed during excisional surgery for this primary arthroplasty. The bacteria appear as redish pink, the blue is reflected light.

TABLE I -

PROBES USES FOR 16S FLUORESCENT IN SITU HYBRIDIZATION

Probe name	Target organism	Sequence (5’ -> 3’)	Reference
Pdi	Brevundimonas	TTC CAC ATA CCT CTC TCA	Schleifer K et al, Molecular Biology and Biotechnology., 1992
TRE II	T. denticola	GCTCCTTTCCTCATTTACCTTTAT	Moter et al, Microbiology, 1998.
ENF 191	Enterococcus faecalis	GAAAGCGCCTTTCACTCTTATGC	Wellinghausen, J. Clin. Microb., 2007

Analyses of native knees for periodontal pathogens

Following our findings that periodontal pathogens were likely associated with a large percentage of infected arthroplasties of the knee, we decided to evaluate native knees from patients planning to undergo primary arthroplasty for osteoarthritis. From a series of pre-surgical aspirates of six such knees, by Ibis we detected T. denticola in 4/6 patients; E. faecalis in 3/6 patients; and 5/6 patients were Ibis-positive for another bacterium or fungus including, Campylobacter concisus, also known to cause periodontal disease, Streptococcus sp. known oral microbes, Staphylococcus hominus, an opportunistic pathogen, Bacillus subtilus an opportunistic pathogen, and finally Aureobasidium sp., a known opportunistic fungal pathogen. None of these pathogens were detected by traditional microbial culture

DISCUSSION

Our experience with the Ibis technology versus traditional microbial culture over the last seven years extends to several thousands of specimens collected and analyzed under the auspices of several national and multi-center bioburden studies (unpublished data). Collectively, the data from these studies indicate, that on average, culture detects an organism in only approximately 20% of the cases that the Ibis does. In all of these studies, the Ibis technology has been verified by either deep 16S rDNA sequence analysis and species- or genera-specific 16S fluorescent in situ hybridization (FISH), or by both (38, 55). Thus, based on these findings we are highly confident that the results we have obtained with the Ibis technology in these various studies, including the current study, are indicative of bacterial presence. Whether the Ibis results obtained from within the joint tissues correlate with the observed inflammation and other pathologies, and therefore, whether they are indicative of an active infection, remains to be determined.

One of the reasons given for the necessity of culture is the need to determine antibiotic resistances and sensitivities of infecting organisms; however, if an infection is only detected by culture 20% of the time in 80% of cases there will be no sensitivity data. Here again the Ibis technology has an advantage, because there are primers included in the BAC eubacterial pan-domain assay to provide a molecular antibiogram. The latter is accomplished by amplification of the genetic determinants of major antibiotic resistances. As a test of the accuracy of this system we examined the identification of the mecA gene in the current PJI study. This gene encodes methicillin resistance among the staphylococci, and therefore should be found preferentially when staphylococci species are also detected. In the current study mecA was never detected in the absence of staphylococcal species - attesting to the specificity of the assay. Similar assays are included in the BAC test for vancomycin and carbapenem resistances.

In this study, in the absence of bacterial culture, multiple periodontal pathogens were identified both in the knees of patients with arthroplasties who were undergoing revisional surgery for either periprosthetic joint infections or “sterile” loosening as well as in the knees of osteoarthritis patients prior to the placement of any arthroplasty. The bacterial species detected included Enterococcus faecalis which is associated with apical periodontitis (infected root canals); as well as Treponema denticola and Brevundimonas diminuta, both associated with gingivitis and periodontitis. Interestingly, none of these periodontal pathogens were ever identified from PJIs of the hip or any other joint. This joint specificity is likely reflective of a bacteremic source of infection wherein the periodontal pathogens enter the blood stream from oral lesions and then settle out in the knee which possesses a unique ramifying end capillary bed structure not present in the other joints. Due to their size, aggregation potential, or specific adherence mechanisms to end capillary walls, periodontal bacteria such as those identified here may establish infection either directly within the capillary or following migration out of the capillaries into the surrounding tissues. The same mechanism likely underlies the development of septic arthritis of the knee much more commonly than of other joints in both humans and other mammals such as the horse and the dog (56).

In the incumbent PJI study we confirmed the Ibis T5000 findings of periodontal bacterial DNA via direct visualization of the Ibis-identified microbes with FISH probes and confocal microscopy as well as by deep 16S pyrosequencing of individual 16S amplicon libraries prepared from individual specimens, when sufficient material was available. In all 10 Ibis-positive cases, 16S FISH verified the presence of the same periodontal bacteria (identified by Ibis) as being present within tissue-embedded biofilms, despite all these cases being culture negative. It is important to point out that the tissue processing steps involved in preparing the specimens for FISH, as well as the FISH procedure itself (54, 55), are very harsh in terms of shear forces encountered by the bacterial biofilms. This results in a very substantial debulking of the biofilm such that any remaining bacteria must be tightly attached to the tissue (hardware) under evaluation. Thus, any contaminating bacteria would not survive the process. This means that FISH-based visualization of a given bacterial taxa is essentially proof-positive not only of its presence but also of its penetration into the tissue.

In our Ibis evaluation of aspirates from native knees prior to their undergoing primary knee arthroplasty (PKA) for treatment of osteoarthritis, we detected the same periodontal pathogens (T. denticola and E. faecalis), as well as Campylobacter concisus, as were detected in the PJI/sterile loosening population. The finding of multiple periodontal pathogens, often in the same joint, suffering from “sterile” loosening indicates that the process is not, in fact, sterile, and raises the question as to what role these pathogens are playing in the failure of these joints. We hypothesize that although they are not associated with high-level activation of the host inflammatory response leading to frank purulence, they are acting – just as they do in the oral cavity – as chronic, slow-growing, inflammatory microbial pathogens clinically associated with maxillary and mandibular bone losses. The pathology may be due either to: 1) a direct effect of the bacterial biofilm acting on (within) the host tissue; or 2) may result from the host’s chronic attempt to respond to the biofilm with the chronic response setting up a break in immunologic tolerance, resulting in the establishment of an auto-immune-like response to cross-reactive knee joint components (e.g., cartilage, synovia, tendons, ligaments, etc.). Either of these hypothetical mechanisms could explain the clinical findings of arthroplastic loosening. Further, we hypothesize that the finding of these same periodontal pathogens in the knees of patients suffering from osteoarthritis indicates that they may play an exacerbatory role in the development of this very common disease. These findings should serve as the bases for future in-depth studies to test the aforementioned hypotheses.

ACKNOWLEDGEMENTS

The authors thank all of the physicians and clinical staff members who provided specimens.

Disclosures

Conflict of interest: FZH received grant support for this study from Abbott Molecular; GDE serves as a consultant to Abbott Molecular.

References

1. Costerton JW.,Geesey GG.,Cheng KJ. How bacteria stick. Sci Am 1978; 238: 86-95 Google Scholar
2. Parsek MR.,Fuqua C. Biofilms 2003: emerging themes and challenges in studies of surface-associated microbial life. J Bacteriol 2004; 186: 4427-4440 Google Scholar
3. Costerton W.,Veeh R.,Shirtliff M.,Pasmore M.,Post C.,Ehrlich GD. The application of biofilm science to the study and control of chronic bacterial infections. J Clin Invest 2003; 112: 1466-1477 Google Scholar
4. Ehrlich GD Hu ZF Post JC Role for Biofilms in Infectious Disease. In: Ghannoum M O’Toole GA (eds) Microbial Biofilms Washington, DC ASM Press 2004 332 358 Google Scholar
5. Nucci C.,Artini M.,Pasmore M.,Missiroli F.,Costerton JW.,Selan L. A microbiological and confocal microscopy study documenting a slime-producing Staphylococcus epidermidis isolated from a nylon corneal suture of a patient with antibiotic-resistant endophthalmitis. Graefes Arch Clin Exp Ophthalmol 2005; 243: 951-954 Google Scholar
6. Ehrlich GD.,Hu FZ.,Shen K.,Stoodley P.,Post JC. Bacterial plurality as a general mechanism driving persistence in chronic infections. Clin Orthop Relat Res 2005; 437: 20-24 Google Scholar
7. Brady RA.,Leid JG.,Calhoun JH.,Costerton JW.,Shirtliff ME. Osteomyelitis and the role of biofilms in chronic infection. FEMS Immunol Med Microbiol 2008; 52: 13-22 Google Scholar
8. Ehrlich GD.,Ahmed A.,Earl J. The distributed genome hypothesis as a rubric for understanding evolution in situ during chronic infectious processes. FEMS Immunol Med Microbiol 2010; 59: 269-279 Google Scholar
9. Høiby N.,Ciofu O.,Johansen HK. The clinical impact of bacterial biofilms. Int J Oral Sci 2011; 3: 55-65 Google Scholar
10. Costerton JW.,Post JC.,Ehrlich GD. New methods for the detection of orthopedic and other biofilm infections. FEMS Immunol Med Microbiol 2011; 61: 133-140 Google Scholar
11. Stoodley P.,Conti SF.,DeMeo PJ. Characterization of a mixed MRSA/MRSE biofilm in an explanted total ankle arthroplasty. FEMS Immunol Med Microbiol 2011; 62: 66-74 Google Scholar
12. Ehrlich GD.,Arciola CR. From Koch’s postulates to biofilm theory. Int J Artif Organs 2012; 35: 695-699 Google Scholar
13. Arciola CR.,Montanaro L.,Costerton JW. New trends in diagnosis and control strategies for implant infections. Int J Artif Organs 2011; 34: 727-736 Google Scholar
14. Arciola CR.,Campoccia D.,Speziale P.,Montanaro L.,Costerton JW. Biofilm formation in Staphylococcus implant infections. Biomaterials 2012; 33: 5967-5982 Google Scholar
15. Hu FZ.,Ehrlich GD. Population-level virulence factors amongst pathogenic bacteria: relation to infection outcome. Future Microbiol 2008; 3: 31-42 Google Scholar
16. Ehrlich GD.,Stoodley P.,Kathju S. Engineering approaches for the detection and control of orthopaedic biofilm infections. Clin Orthop Relat Res 2005; 437: 59-66 Google Scholar
17. Hiller NL.,Ahmed A.,Powell E. Generation of genic diversity among Streptococcus pneumoniae strains via horizontal gene transfer during a chronic polyclonal pediatric infection. PLoS Pathog 2010; 6: - Google Scholar
18. Hu FZ.,Eutsey R.,Ahmed A. In vivo capsular switch in Streptococcus pneumoniae--analysis by whole genome sequencing. PLoS ONE 2012; 7: - Google Scholar
19. Davies DG.,Parsek MR.,Pearson JP.,Iglewski BH.,Costerton JW.,Greenberg EP. The involvement of cell-to-cell signals in the development of a bacterial biofilm. Science 1998; 280: 295-298 Google Scholar
20. Dandekar AA.,Chugani S.,Greenberg EP. Bacterial quorum sensing and metabolic incentives to cooperate. Science 2012; 338: 264-266 Google Scholar
21. Swords WE. Quorum signaling and sensing by nontypeable Haemophilus influenzae. Front Cell Infect Microbiol 2012; 2: -100 Google Scholar
22. Ehrlich GD.,Hiller NL.,Hu FZ. What makes pathogens pathogenic. Genome Biol 2008; 9: - 225 Google Scholar
23. Ehrlich GD.,Hu FZ.,Lin Q.,Costerton JW.,Post JC. Intelligent Implants to Battle Biofilms. ASM News (Microbe) 2004; 70: 127-133 Google Scholar
24. Fux C.,Quigley AM.,Worel A. Biofilm-related infections of cerebro-spinal fluid shunts. Clin Microbiol Infect 2006; 12: 331-337 Google Scholar
25. Kathju S.,Nistico L.,Hall-Stoodley L.,Post JC.,Ehrlich GD.,Stoodley P. Chronic surgical site infection due to suture-associated polymicrobial biofilm. Surg Infect (Larchmt) 2009; 10: 457-461 Google Scholar
26. Harro JM.,Peters BM.,O’May GA. Vaccine development in Staphylococcus aureus: taking the biofilm phenotype into consideration. FEMS Immunol Med Microbiol 2010; 59: 306-323 Google Scholar
27. Artini M.,Romanò C.,Manzoli L. Staphylococcal IgM enzyme-linked immunosorbent assay for diagnosis of periprosthetic joint infections. J Clin Microbiol 2011; 49: 423-425 Google Scholar
28. Givskov M.,de Nys R.,Manefield M. Eukaryotic interference with homoserine lactone-mediated prokaryotic signalling. J Bacteriol 1996; 178: 6618-6622 Google Scholar
29. Bjarnsholt T.,Givskov M. Quorum sensing inhibitory drugs as next generation antimicrobials: worth the effort? Curr Infect Dis Rep 2008; 10: 22-28 Google Scholar
30. Artini M.,Papa R.,Barbato G. Bacterial biofilm formation inhibitory activity revealed for plant derived natural compounds. Bioorg Med Chem 2012; 20: 920-926 Google Scholar
31. Papa R.,Artini M.,Cellini A. A new anti-infective strategy to reduce the spreading of antibiotic resistance by the action on adhesion-mediated virulence factors in Staphylococcus aureus. Microb Pathog 2013; 63: 44-53 Google Scholar
32. Tan SY.,Chua SL.,Yicai C.,Rice SA.,Kjelleberg S.,Nielsen TE.,Yang L.,Givskov M. Identification of Five Structurally Unrelated Quorum Sensing Inhibitors of Pseudomonas aeruginosa from a Natural Derivative Database. Antimicrob Agents Chemother 2013; : - Google Scholar
33. Papa R.,Parrilli E.,Sannino F. Anti-biofilm activity of the Antarctic marine bacterium Pseudoalteromonas haloplanktis TAC125. Res Microbiol 2013; 164: 450-456 Google Scholar
34. Stoodley P.,Kathju S.,Hu FZ. Molecular and imaging techniques for bacterial biofilms in joint arthroplasty infections. Clin Orthop Relat Res 2005; 437: 31-40 Google Scholar
35. Kathju S.,Lasken RS.,Satish L. Multiple displacement amplification as an adjunct to PCR-based detection of Staphylococcus aureus in synovial fluid. BMC Res Notes 2010; 3: -259 Google Scholar
36. Stoodley P.,Ehrlich GD.,Sedghizadeh PP. Orthopaedic biofilm infections. Curr Orthop Pract 2011; 22: 558-563 Google Scholar
37. Gallo PH.,Melton-Kreft R.,Nistico L. Demonstration of Bacillus cereus in orthopaedic-implant-related infection with use of a multi-primer polymerase chain reaction-mass spectrometric assay: report of two cases. J Bone Joint Surg Am 2011; 93: - Google Scholar
38. Jacovides CL.,Kreft R.,Adeli B.,Hozack B.,Ehrlich GD.,Parvizi J. Successful identification of pathogens by polymerase chain reaction (PCR)-based electron spray ionization time-of-flight mass spectrometry (ESI-TOF-MS) in culture-negative periprosthetic joint infection. J Bone Joint Surg Am 2012; 94: 2247-2254 Google Scholar
39. Choi HR.,Kwon YM.,Freiberg AA.,Nelson SB.,Malchau H. Periprosthetic joint infection with negative culture results: clinical characteristics and treatment outcome. J Arthroplasty 2013; 28: 899-903 Google Scholar
40. Palmer MP.,Altman D.,Alman G. Can We Trust Intraoperative Culture Results in Nonunions? J Orthop Trauma 2013; : - Google Scholar
41. Howe TS.,Ehrlich GD.,Koh SB.,Costerton W. A Case of an Atypical Femoral Fracture Associated with Bacterial Biofilm - Pathogen or Bystander? Osteoporos Int 2013; 24: 1765-6 Google Scholar
42. Sotereanos N Second-generation molecular diagnostics and strategies for preventing periprosthetic joint infections. In: Ehrlich GD DeMeo P Costerton JW Winkler H eds. Culture-Negative Orthopedic Biofilm Infections. Berlin, Heidelberg Springer-Verlag (Series on Biofilms) 2012 Google Scholar
43. Borriello G.,Werner E.,Roe F.,Kim AM.,Ehrlich GD.,Stewart PS. Oxygen limitation contributes to antibiotic tolerance of Pseudomonas aeruginosa in biofilms. Antimicrob Agents Chemother 2004; 48: 2659-2664 Google Scholar
44. Nguyen D.,Joshi-Datar A.,Lepine F. Active starvation responses mediate antibiotic tolerance in biofilms and nutrient-limited bacteria. Science 2011; 334: 982-986 Google Scholar
45. Borriello G.,Richards L.,Ehrlich GD.,Stewart PS. Arginine or nitrate enhances antibiotic susceptibility of Pseudomonas aeruginosa in biofilms. Antimicrob Agents Chemother 2006; 50: 382-384 Google Scholar
46. Stewart S.,Barr S.,Engiles J. Vancomycin-modified implant surface inhibits biofilm formation and supports bone-healing in an infected osteotomy model in sheep: a proof-of-concept study. J Bone Joint Surg Am 2012; 94: 1406-1415 Google Scholar
47. Ehrlich GD DeMeo P Costerton JW Winkler H eds. Culture-Negative Orthopedic Biofilm Infections. Berlin, Heidelberg Springer-Verlag (Series on Biofilms) 2012 Google Scholar
48. Ehrlich GD. Syndromic Illnesses Demand Multiplex PCR-Based Assays. Mol Diagn 1996; 1: 83-87 Google Scholar
49. Ehrlich GD Greenberg SJ The Need for PCR-based Panel Testing for Syndromic Infectious Diseases. Boston Blackwell Scientific Publications 1994 Google Scholar
50. Ecker DJ.,Sampath R.,Massire C. Ibis T5000: a universal biosensor approach for microbiology. Nat Rev Microbiol 2008; 6: 553-558 Google Scholar
51. Boase S.,Foreman A.,Cleland E. The microbiome of chronic rhinosinusitis: culture, molecular diagnostics and biofilm detection. BMC Infect Dis 2013; : -210 Google Scholar
52. Yun HC.,Kreft RE.,Castillo MA. Comparison of PCR/electron spray ionization-time-of-flight-mass spectrometry versus traditional clinical microbiology for active surveillance of organisms contaminating high-use surfaces in a burn intensive care unit, an orthopedic ward and healthcare workers. BMC Infect Dis 2012; 12: -252 Google Scholar
53. Sampath R.,Hall TA.,Massire C. Rapid identification of emerging infectious agents using PCR and electrospray ionization mass spectrometry. Ann N Y Acad Sci 2007; 1102: 109-120 Google Scholar
54. Nistico L.,Gieseke A.,Stoodley P.,Hall-Stoodley L.,Kerschner JE.,Ehrlich GD. Fluorescence “in situ” hybridization for the detection of biofilm in the middle ear and upper respiratory tract mucosa. Methods Mol Biol 2009; : 191-213 Google Scholar
55. Nistico L.,Gieseke A.,Kreft R. Adenoid reservoir for pathogenic biofilm bacteria. J Clin Microbiol 2011; 49: 1411-1420 Google Scholar
56. Percival SL.,Knottenbelt DC.,Cochrane CA. Biofilms and Veterinary Medicine Heidelberg Dordrecht London New York 2011; : - Google Scholar

Authors

Ehrlich, Garth D. [PubMed] [Google Scholar] 1, 3, * Corresponding Author ([email protected])
Hu, Fen Z. [PubMed] [Google Scholar] 1, 3
Sotereanos, Nicholas [PubMed] [Google Scholar] 4
Sewicke, Jeffrey [PubMed] [Google Scholar] 4
Parvizi, Javad [PubMed] [Google Scholar] 5
Nara, Peter L. [PubMed] [Google Scholar] 6
Arciola, Carla Renata [PubMed] [Google Scholar] 7, 8, * Corresponding Author ([email protected])

Affiliations

1 Center for Genomic Sciences, Institute for Molecular Medicine and Infections Disease, Drexel University College of Medicine, Philadelphia, PA - USA
2 Department of Microbiology and Immunology, Drexel University College of Medicine, Philadelphia, PA - USA
3 Department of Otolaryngology, Drexel University College of Medicine, Philadelphia, PA - USA
4 Department of Orthopedic Surgery, Allegheny General Hospital, Pittsburgh, PA - USA
5 Rothman Institute at Thomas Jefferson University, Philadelphia, PA - USA
6 Biological Mimetics Inc., Frederick, MD - USA
7 Research Unit on Implant Infections, Rizzoli Orthopedic Institute, Bologna - Italy
8 DIMES, University of Bologna, Bologna - Italy

Article usage statistics

The blue line displays unique views in the time frame indicated.
The yellow line displays unique downloads.
Views and downloads are counted only once per session.

No supplementary material is available for this article.